Fasta Header Replacer

Handling sequence files (like .fasta) is one of the trickiest problems for novice in Bioinformatics. Bio-Perl, Bio-python are quite useful but looks really scary :-( !.
MATLAB offers a cool solution with its in-built Bioinformatics toolbox !!. Reading a fasta file with 'fastaread' is as easy as 'xlsread' ...followingly the same with 'fastawrite'/'xlswrite' :-)

fastaread simply extract the sequence headers & sequences in cell arrays !. Voila !!! Once it does...then one can do all kinds of manipulation they want.

Here is a simple-self-explanatory, one-file-at-a-time code to replace the header with an user-defined headers. Besides, creates a translation table. If you want to process multiple file then one can readily loop it over directory operations.

INPUT (sequence.fasta)

>gi|154163|gb|M83220.1|STYLEXA Salmonella typhimurium lexA (repressor of DNA damage inducible genes) gene, 5' end
ATGCGCCAGCTGCAAAATTTAAAT

>gi|154164|gb|M83220.1|STYLEXA Salmonella typhimurium lexA (repressor of DNA damage inducible genes) gene, 5'end
ATGCGCCAGCTGCAAAATTTAAAT

OUTPUT1(Testout.fasta):
>1_Org
ATGCGCCAGCTGCAAAATTTAAAT

>2_Org
ATGCGCCAGCTGCAAAATTTAAAT

OUTPUT2: (TransTab.txt)
gi|154163|gb|M83220.1|STYLEXA Salmonella typhimurium lexA .....5' end    1_Org
gi|154164|gb|M83220.1|STYLEXA Salmonella typhimurium lexA .....5' end    2_Org


%Author: Arun Prasanna
%M-CODE to replace old header with new ones in fasta file !.
%Output files are 1. .fasta file with new header & sequence
%=================2. Translation table with old & new header
% Algo: Read a fastafile -> store head, seq as cell -> generate
% new header names -> write output with new header, sequence pairs; 
% write translation table

clear; clc;
[Header, Seq] = fastaread('sequence.fasta');
Header = Header';
Seq= Seq';
[rH,cH] = size(Header);
for i = 1:rH
    id = num2str(i)
    org_name = '_Org';
    new{i,1} = strcat(id,org_name)
end
fastawrite('Testout.fasta',new,Seq);
TransTab = horzcat(Header,new);
%===========Section-to-write-cell-array-2-Txt-file===========%
fileID = fopen('TransTab.txt','w');
[nrows,ncols] = size(TransTab);
for row = 1:nrows
    fprintf(fileID,'%s\t%s\n',TransTab{row,:});
end
disp('Program Complete')

Comments

Post a Comment

Popular posts from this blog

Fasta_Dupicate_Header

A simple, self-explanatory matlab code to identify duplicate headers in fasta files. 1  2  3  4  5  6  7  8  9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 %Simple matlab code to check for the duplicate header in fasta files %Store the size of header -> unique(header) ->size of new header %Copy the Table data in excel and compare the two values clear; clc; tic; Path = 'Drive\Path\FileName' ; % FileList = dir(Path); [rFL, cFL] = size(FileList); for i = 3:rFL %i of 1 & 2 are . & .. respectively     Fas_Fname{i-2,1} = FileList(i).name; %FileList is a structure end [rFas,cFas] = size(Fas_Fname); for i = 1:rFas     clear Header Seq Old_Header Unik_header     OpenFile = cell2mat(strcat(Path,Fas_Fname(i)));     [Header, Seq] = fastaread(OpenFile);[rH,cH] = size(Header);     Old_Header = length(Header);     Unik_header = length(unique(Header));     Table{i,1} = Fas_Fname(i);     Table{i,2} = num2str(Old_Header);     Table{i,3} = num2str(Unik_heade
Read more

Gene Copy Number Matrix

Given a cluster file, one can create a gene copy number matrix (GCN). With this self-explanatory simple matlab file it is easy to create one. Input Format: Cluster file.xlsx: (1) A  B  C  D (2) A  A  A (3) B C (4) D D A List File.xlsx: A B C D Output: (of course, the output will have the file with only numbers printed)      A B C D (1) 1  1  1  1 (2) 3  0  0  0 (3) 0  1  1  0 (4) 1  0  0  2 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 %Author = Arun Prasanna %Create a gene copy number matrix from cluster information clear ; clc ; tic [ mat1 , mat ] = xlsread ( 'ClusterFile.xlsx' , 'Sheet1' ); clear mat1 [ mat2 , head ] = xlsread ( 'Organism_list.xlsx' , 'Sheet1' ); clear mat2 %species/gene name new_head = head (:, 1 ) ' ; %transpose to make it as header [ rmat , cmat ] = size ( mat ); [ rhead , chead ] = size ( new_head ); out = zeros ( rmat , chead );
Read more

Fasta_Header_Rename

A simple matlab code to rename the headers in fasta file. Self-explanatory variable names. 1  2  3  4  5  6  7  8  9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 %Author = Arun Prasanna %Rename the headers in fasta file to desired choice %For example: The input fasta file used here had header in >num_name format %strtok is used to strip and extract the required format clear; clc; tic; Path = 'Drive\Path\ToReadFile' ; % FileList = dir(Path); [rFL, cFL] = size(FileList); for i = 3:rFL %i of 1 & 2 are . & .. respectively     Fas_Fname{i-2,1} = FileList(i).name; %FileList is a structure end [rFas,cFas] = size(Fas_Fname); for i = 1:rFas     clear Header Seq ProtID Sp new_Header     OpenFile = cell2mat(strcat(Path,Fas_Fname(i)));     [Header, Seq] = fastaread(OpenFile);[rH,cH] = size(Header);     for j = 1:cH         [ProtID, Sp] = strtok(Header(1,j), '_' ); %First Sp = _name         [Sp, rm] = strtok(Sp, '_' ); %Se
Read more