Fasta Header Replacer

Handling sequence files (like .fasta) is one of the trickiest problems for novice in Bioinformatics. Bio-Perl, Bio-python are quite useful but looks really scary :-( !.
MATLAB offers a cool solution with its in-built Bioinformatics toolbox !!. Reading a fasta file with 'fastaread' is as easy as 'xlsread' ...followingly the same with 'fastawrite'/'xlswrite' :-)

fastaread simply extract the sequence headers & sequences in cell arrays !. Voila !!! Once it does...then one can do all kinds of manipulation they want.

Here is a simple-self-explanatory, one-file-at-a-time code to replace the header with an user-defined headers. Besides, creates a translation table. If you want to process multiple file then one can readily loop it over directory operations.

INPUT (sequence.fasta)

>gi|154163|gb|M83220.1|STYLEXA Salmonella typhimurium lexA (repressor of DNA damage inducible genes) gene, 5' end
ATGCGCCAGCTGCAAAATTTAAAT

>gi|154164|gb|M83220.1|STYLEXA Salmonella typhimurium lexA (repressor of DNA damage inducible genes) gene, 5'end
ATGCGCCAGCTGCAAAATTTAAAT

OUTPUT1(Testout.fasta):
>1_Org
ATGCGCCAGCTGCAAAATTTAAAT

>2_Org
ATGCGCCAGCTGCAAAATTTAAAT

OUTPUT2: (TransTab.txt)
gi|154163|gb|M83220.1|STYLEXA Salmonella typhimurium lexA .....5' end    1_Org
gi|154164|gb|M83220.1|STYLEXA Salmonella typhimurium lexA .....5' end    2_Org


%Author: Arun Prasanna
%M-CODE to replace old header with new ones in fasta file !.
%Output files are 1. .fasta file with new header & sequence
%=================2. Translation table with old & new header
% Algo: Read a fastafile -> store head, seq as cell -> generate
% new header names -> write output with new header, sequence pairs; 
% write translation table

clear; clc;
[Header, Seq] = fastaread('sequence.fasta');
Header = Header';
Seq= Seq';
[rH,cH] = size(Header);
for i = 1:rH
    id = num2str(i)
    org_name = '_Org';
    new{i,1} = strcat(id,org_name)
end
fastawrite('Testout.fasta',new,Seq);
TransTab = horzcat(Header,new);
%===========Section-to-write-cell-array-2-Txt-file===========%
fileID = fopen('TransTab.txt','w');
[nrows,ncols] = size(TransTab);
for row = 1:nrows
    fprintf(fileID,'%s\t%s\n',TransTab{row,:});
end
disp('Program Complete')

Comments

Post a Comment

Popular posts from this blog

Pick Matching lines with list of keywords

#Simple code to find the occurrence of list of search terms in single line in a huge file. Search_terms = [ 'A' , 'B' , 'C' , 'D' ] with open ( 'BigFile.txt' , 'r' ) as infile : entries = infile . read () each_line = entries . splitlines () new_list = [] for ix , row in enumerate ( each_line ): element = row . split ( "\t" ) if set ( Search_terms ) == set ( element ): #Use <= if you want no strict option new_list . append ( element ) print ix + 1 #List the matching line number ! thefile = open ( 'Output.txt' , 'w' ) for item in new_list : print >> thefile , item
Read more

Install Parallel versions of Python from source

Few programs require certain versions of python. Especially, when you do not have root permission in your unix machine, you can still install a python version in your /home/usr directory. You can run it in parallel to in-built version. Follow these steps: 1. Unpack with  tar -xvf python-x.x.tar 2. ./configure 3. make altinstall prefix=~ exec-prefix=~ (./lib and ./bin will be created in your home directory(~)) 4. create alias for python-x.x => i.e cd ~/bin/ > ln -s python-x.x python ! If you create this outside bin directory, you will get a warning (ln: symbolic link already exists !! remember it refers to inbuilt python) 5. Complete alias creation by editing: vi ~/.bashrc with alias python='~/bin/python' Now any software you try to install with python setup.py it will access the version you installed in your home ! You can still install softwares using your version by skipping steps 4 & 5. But, everytime you need to keep specifying the export PATH ...
Read more

Map multiple annotations using pandas

A simple pandas solution to map multiple annotations for a protein.  A protein or gene file will have annotations curated by different methods. Most frequently, biologists will encounter more than one annotation for a single protein. It is a task in itself to pick the right annotation.  One of the simple ways is to consolidate them and pick the right ones after enough evidence is known.  Coding i n matlab or other languages may require more number of lines to achieve the same output. Here, a simple 'groupby' of pandas can do produce the same outputin seconds ! # Map multiple annotation for protein ID and join with a delimiter ''' Sample input A_xx Annotation1 A_xx Annotation2 B_xx Annotation1 Sample output A_xx Annotation1, Annotation2 B_xx Annotation1 ''' import pandas as pd data = pd . read_csv( 'input_file.txt' , delimiter = ' \t ' ) dfc = data . groupby([ 'PROTID' ])[ 'ANNOTATION...
Read more