Working algos for Biological Data: Simple to Complex problems

A simple matlab code to rename the headers in fasta file. Self-explanatory variable names. 1  2  3  4  5  6  7  8  9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 %Author = Arun Prasanna %Rename the headers in fasta file to desired choice %For example: The input fasta file used here had header in >num_name format %strtok is used to strip and extract the required format clear; clc; tic; Path = 'Drive\Path\ToReadFile' ; % FileList = dir(Path); [rFL, cFL] = size(FileList); for i = 3:rFL %i of 1 & 2 are . & .. respectively     Fas_Fname{i-2,1} = FileList(i).name; %FileList is a structure end [rFas,cFas] = size(Fas_Fname); for i = 1:rFas     clear Header Seq ProtID Sp new_Header     OpenFile = cell2mat(strcat(Path,Fas_Fname(i)));     [Header, Seq] = fastaread(OpenFile);[rH,cH] = size(Header);     for j = 1:cH    ...

A simple, self-explanatory matlab code to identify duplicate headers in fasta files. 1  2  3  4  5  6  7  8  9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 %Simple matlab code to check for the duplicate header in fasta files %Store the size of header -> unique(header) ->size of new header %Copy the Table data in excel and compare the two values clear; clc; tic; Path = 'Drive\Path\FileName' ; % FileList = dir(Path); [rFL, cFL] = size(FileList); for i = 3:rFL %i of 1 & 2 are . & .. respectively     Fas_Fname{i-2,1} = FileList(i).name; %FileList is a structure end [rFas,cFas] = size(Fas_Fname); for i = 1:rFas     clear Header Seq Old_Header Unik_header     OpenFile = cell2mat(strcat(Path,Fas_Fname(i)));     [Header, Seq] = fastaread(OpenFile);[rH,cH] = size(Header);     Old_Header = length(Header);     Unik_header = length(...

Extension of previous code 'Fasta Header Replacer.m' to process files in batch mode. Keep all/only the .fasta files inside the specified directory. %Author: Arun Prasanna %Version 2.0 of Fasta_Header_replacer.m!. %Efficient to process files in batch mode. clear ; clc ; FileList = dir ( 'D:\BRC_POSTDOC-RESEARCH\ARMILLARIA_Project\PROTEIN_FASTA' ); [ rFL , cFL ] = size ( FileList ); for i = 3 : rFL %i of 1 & 2 are . & .. respectively     Org_name { i - 2 , 1 } = FileList ( i ). name ; %FileList is a structure end [ rOn , cOn ] = size ( Org_name ); for OL = 1 : rOn     FileName = char ( Org_name { OL });     [ Header , Seq ] = fastaread ( FileName );     Header = Header ' ;     Seq = Seq ' ;     [ rH , cH ] = size ( Header );     check ( OL , 1 ) = rH ;     for IL = 1 : rH      ...

Handling sequence files (like .fasta) is one of the trickiest problems for novice in Bioinformatics. Bio-Perl, Bio-python are quite useful but looks really scary :-( !. MATLAB offers a cool solution with its in-built Bioinformatics toolbox !!. Reading a fasta file with 'fastaread' is as easy as 'xlsread' ...followingly the same with 'fastawrite'/'xlswrite' :-) fastaread simply extract the sequence headers & sequences in cell arrays !. Voila !!! Once it does...then one can do all kinds of manipulation they want. Here is a simple-self-explanatory, one-file-at-a-time code to replace the header with an user-defined headers. Besides, creates a translation table. If you want to process multiple file then one can readily loop it over directory operations. INPUT (sequence.fasta) >gi|154163|gb|M83220.1|STYLEXA Salmonella typhimurium lexA (repressor of DNA damage inducible genes) gene, 5' end ATGCGCCAGCTGCAAAATTTAAAT >gi|154164|gb|M8322...

Given a cluster file, one can create a Presence-Absence matrix (PA map). With this self-explanatory simple matlab file it is easy to create one. Input Format: Cluster file.xlsx: (1) A  B  C  D (2) A  A  A (3) B C (4) D D A List File.xlsx: A B C D Output : (of course, the output will have the file with only numbers printed)      A B C D (1) 1  1  1  1 (2) 1  0  0  0 (3) 0  1  1  0 (4) 1  0  0  1 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 %Author = Arun Prasanna %Create a presence absence matrix (PA map) from cluster information clear ; clc ; [ mat1 , mat ] = xlsread ( 'ClusterFile.xlsx' , 'Sheet1' ); clear mat1 [ mat2 , head ] = xlsread ( 'List.xlsx' , 'Header' ); clear mat2 new_head = head (:, col_val ); %col_val = 2 => column that has unique sp/gene list [ rmat , cmat ] ...

Given a cluster file, one can create a gene copy number matrix (GCN). With this self-explanatory simple matlab file it is easy to create one. Input Format: Cluster file.xlsx: (1) A  B  C  D (2) A  A  A (3) B C (4) D D A List File.xlsx: A B C D Output: (of course, the output will have the file with only numbers printed)      A B C D (1) 1  1  1  1 (2) 3  0  0  0 (3) 0  1  1  0 (4) 1  0  0  2 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 %Author = Arun Prasanna %Create a gene copy number matrix from cluster information clear ; clc ; tic [ mat1 , mat ] = xlsread ( 'ClusterFile.xlsx' , 'Sheet1' ); clear mat1 [ mat2 , head ] = xlsread ( 'Organism_list.xlsx' , 'Sheet1' ); clear mat2 %species/gene name new_head = head (:, 1 ) ' ; %transpose to make it as header [ rmat , cm...